Stem-loop sequence mmu-mir-6964

AccessionMI0022811 (change log)
Symbol MGI:Mir6964
DescriptionMus musculus miR-6964 stem-loop
Stem-loop
   cccccu       ug    u     cau  c 
5'       uggggug  agac ggaaa   ca c
         |||||||  |||| |||||   ||  
3'       aucucac  ucug ucuuu   gu a
   -----g       cu    u     cuu  u 
Get sequence
Deep sequencing
72 reads, 0 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 97877233-97877291 [-]
sense
ENSMUST00000170757 ; C2cd2-201; intron 8
Database links

Mature sequence mmu-miR-6964-5p

Accession MIMAT0027828
Sequence

6 - 

uuggggugugagacuggaaac

 - 26

Get sequence
Deep sequencing41 reads, 15 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6964-3p

Accession MIMAT0027829
Sequence

40 - 

uuucuugucuuccacucuag

 - 59

Get sequence
Deep sequencing31 reads, 19 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).