Stem-loop sequence mmu-mir-6963

AccessionMI0022810 (change log)
Symbol MGI:Mir6963
DescriptionMus musculus miR-6963 stem-loop
Stem-loop
   gggaag          u    gaaccu    auu uu  ca 
5'       gugggaugga ggca      ggag   c  gu  a
         |||||||||| ||||      ||||   |  ||   
3'       cacccuaccu ccgu      ucuc   g  cg  a
   ----ga          -    ------    --c uu  uc 
Get sequence
Deep sequencing
97 reads, 3.85 reads per million, 26 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 103350455-103350525 [-]
sense
ENSMUST00000023128 ; Itga5-201; intron 22
Database links

Mature sequence mmu-miR-6963-5p

Accession MIMAT0027826
Sequence

6 - 

ggugggauggauggcagaaccugg

 - 29

Get sequence
Deep sequencing62 reads, 19 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6963-3p

Accession MIMAT0027827
Sequence

49 - 

ugccucuugccuccaucccacag

 - 71

Get sequence
Deep sequencing32 reads, 9 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).