Stem-loop sequence mmu-mir-6923

AccessionMI0022770 (change log)
Symbol MGI:Mir6923
DescriptionMus musculus miR-6923 stem-loop
Literature search

1 open access papers mention mmu-mir-6923
(1 sentences)

Stem-loop
   guga   c       uu       gaggguccaccc 
5'     ggg aggagga  ggggugu            c
       ||| |||||||  |||||||            a
3'     ccc uccuccu  ccucaca            g
   --ga   c       -c       guaugucacgca 
Get sequence
Deep sequencing
113 reads, 40 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 67099804-67099875 [+]
sense
OTTMUST00000013182 ; Myh3-001; intron 35
ENSMUST00000165221 ; Myh3-202; intron 34
ENSMUST00000007301 ; Myh3-201; intron 34
ENSMUST00000108689 ; Myh3-001; intron 35
Database links

Mature sequence mmu-miR-6923-5p

Accession MIMAT0027746
Sequence

1 - 

gugagggcaggaggauuggggugu

 - 24

Get sequence
Deep sequencing58 reads, 8 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6923-3p

Accession MIMAT0027747
Sequence

52 - 

acacucccuccuccuccccag

 - 72

Get sequence
Deep sequencing51 reads, 12 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).