Stem-loop sequence mmu-mir-6910

AccessionMI0022757 (change log)
Symbol MGI:Mir6910
DescriptionMus musculus miR-6910 stem-loop
Stem-loop 
   gcac    -----    a   c    g       -  u 
5'     cugg     gggu ggg acca ugggcag ag g
       ||||     |||| ||| |||| ||||||| ||  
3'     gacc     ccca ccu uggu acucguc uc u
   ----    uguuu    -   u    -       g  c
Get sequence
Deep sequencing
41 reads, 0 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 79862587-79862652 [+]
sense
OTTMUST00000090672 ; Ptbp1-006; intron 1
OTTMUST00000090671 ; Ptbp1-018; intron 2
OTTMUST00000090670 ; Ptbp1-017; intron 5
OTTMUST00000090661 ; Ptbp1-008; intron 9
OTTMUST00000090658 ; Ptbp1-002; intron 10
OTTMUST00000090659 ; Ptbp1-004; intron 10
OTTMUST00000090666 ; Ptbp1-005; intron 10
OTTMUST00000090655 ; Ptbp1-001; intron 11
ENSMUST00000169580 ; Ptbp1-006; intron 1
ENSMUST00000164385 ; Ptbp1-018; intron 2
ENSMUST00000165724 ; Ptbp1-017; intron 5
ENSMUST00000057343 ; Ptbp1-008; intron 9
ENSMUST00000165704 ; Ptbp1-002; intron 10
ENSMUST00000165153 ; Ptbp1-004; intron 10
ENSMUST00000095457 ; Ptbp1-005; intron 10
ENSMUST00000172282 ; Ptbp1-001; intron 11
antisense
OTTMUST00000090674 ; RP23-13B8.8-002; intron 7
ENSMUST00000167250 ; BC005764-002; intron 7
Database links

Mature sequence mmu-miR-6910-5p

Accession MIMAT0027720
Sequence

6 -  

uggggguagggcaccagugggca

 - 28

Get sequence
Deep sequencing29 reads, 20 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6910-3p

Accession MIMAT0027721
Sequence

43 -  

ucaugguuuccacccuuugucc

 - 64

Get sequence
Deep sequencing11 reads, 8 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).