Stem-loop sequence mmu-mir-6906

AccessionMI0022753 (change log)
Symbol MGI:Mir6906
DescriptionMus musculus miR-6906 stem-loop
Stem-loop
   ga    u   c    -   ---   ac  ca 
5'   ugga ggg agac gga   cag  ag  g
     |||| ||| |||| |||   |||  ||   
3'   accu ucc ucug ccu   guc  uc  a
   -g    c   -    g   uaa   ca  cg 
Get sequence
Deep sequencing
77 reads, 0 reads per million, 33 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 60126776-60126833 [+]
sense
OTTMUST00000073922 ; Spock2-002; intron 7
OTTMUST00000073921 ; Spock2-001; intron 7
ENSMUST00000138976 ; Spock2-002; intron 7
ENSMUST00000121820 ; Spock2-001; intron 7
ENSMUST00000165024 ; Spock2-201; intron 7
Database links

Mature sequence mmu-miR-6906-5p

Accession MIMAT0027712
Sequence

2 - 

auggaugggcagacggacagacag

 - 25

Get sequence
Deep sequencing38 reads, 19 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6906-3p

Accession MIMAT0027713
Sequence

38 - 

gaauuccggucuccucuccag

 - 58

Get sequence
Deep sequencing27 reads, 11 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).