Stem-loop sequence mmu-mir-6898

AccessionMI0022745 (change log)
Symbol MGI:Mir6898
DescriptionMus musculus miR-6898 stem-loop
Stem-loop
   aucc   -ua       a         ccaugccgaauga 
5'     cug   aggggag ugcagggag             u
       |||   ||||||| |||||||||              
3'     gac   ucucuuc auguuucuc             g
   ----   cca       c         ugaacuuagguuc 
Get sequence
Deep sequencing
47 reads, 0 reads per million, 28 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 36348682-36348758 [-]
sense
ENSMUST00000010597 ; Kansl3-201; intron 13
Database links

Mature sequence mmu-miR-6898-5p

Accession MIMAT0027696
Sequence

6 - 

uguaaggggagaugcagggagc

 - 27

Get sequence
Deep sequencing42 reads, 25 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6898-3p

Accession MIMAT0027697
Sequence

51 - 

aagucucuuuguaccuucucu

 - 71

Get sequence
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).