Stem-loop sequence hsa-mir-6847

Accession

MI0022693 (change log)

Symbol

HGNC:MIR6847

Description

Homo sapiens miR-6847 stem-loop

Stem-loop

   gacccac         ugga ug      gga   ag 
5'        agaggacag    g  ugagcu   agg  u
          |||||||||    |  ||||||   |||   
3'        ucuccuguc    u  acucgg   ucc  g
   --gaccu         --ug gu      ---   gg 

Deep sequencing

153 reads, 0 reads per million, 50 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr8: 144079874-144079942 [+]
• Overlapping transcripts:

  antisense

  OTTHUMT00000380063 ; RP11-273G15.2-003; intron 1

  OTTHUMT00000380065 ; RP11-273G15.2-005; intron 1

  OTTHUMT00000380064 ; RP11-273G15.2-004; intron 2

  ENST00000517833 ; RP11-273G15.2-003; intron 1

  ENST00000518024 ; RP11-273G15.2-005; intron 1

  ENST00000522060 ; RP11-273G15.2-004; intron 2

Database links

• HGNC:MIR6847
• miRBase Tracker:MI0022693

Mature sequence hsa-miR-6847-5p

• Accession: MIMAT0027594
• Sequence: 6 - acagaggacaguggagugugagc - 28
• Deep sequencing: 131 reads, 39 experiments
• Evidence: experimental; meta-analysis [1]
• Predicted targets:
  • TargetScanVert:hsa-miR-6847-5p
  • miRDB:hsa-miR-6847-5p

Mature sequence hsa-miR-6847-3p

• Accession: MIMAT0027595
• Sequence: 45 - ggcucaugugucuguccucuuc - 66
• Deep sequencing: 15 reads, 12 experiments
• Evidence: experimental; meta-analysis [1]
• Predicted targets:
  • TargetScanVert:hsa-miR-6847-3p
  • miRDB:hsa-miR-6847-3p

References

1. PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).