Stem-loop sequence hsa-mir-6836

AccessionMI0022682 (change log)
Symbol HGNC:MIR6836
DescriptionHomo sapiens miR-6836 stem-loop
Literature search

1 open access papers mention hsa-mir-6836
(1 sentences)

Stem-loop 
   ggcucc  a     cu  c c      ---  aga 
5'       gc gggcc  gg g aggcau   cc   c
         || |||||  || | ||||||   ||    
3'       cg cccgg  cc c uccgua   gg   a
   ----ga  c     cc  - -      agc  gcg
Get sequence
Deep sequencing
98 reads, 10.3 reads per million, 39 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 2257515-2257577 [-]
sense
OTTHUMT00000322876 ; MAD1L1-008; intron 1
OTTHUMT00000322875 ; MAD1L1-007; intron 4
OTTHUMT00000322874 ; MAD1L1-006; intron 4
OTTHUMT00000322870 ; MAD1L1-002; intron 5
OTTHUMT00000322869 ; MAD1L1-001; intron 7
OTTHUMT00000322871 ; MAD1L1-003; intron 7
ENST00000469871 ; MAD1L1-008; intron 1
ENST00000445959 ; MAD1L1-007; intron 4
ENST00000429625 ; MAD1L1-006; intron 4
ENST00000402746 ; MAD1L1-002; intron 5
ENST00000265854 ; MAD1L1-201; intron 6
ENST00000399654 ; MAD1L1-001; intron 7
ENST00000406869 ; MAD1L1-003; intron 7
Database links

Mature sequence hsa-miR-6836-5p

Accession MIMAT0027574
Sequence

6 -  

cgcagggcccuggcgcaggcau

 - 27

Get sequence
Deep sequencing27 reads, 14 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6836-3p

Accession MIMAT0027575
Sequence

43 -  

augccucccccggccccgcag

 - 63

Get sequence
Deep sequencing71 reads, 38 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).