Stem-loop sequence hsa-mir-6772

AccessionMI0022617 (change log)
Symbol HGNC:MIR6772
DescriptionHomo sapiens miR-6772 stem-loop
Stem-loop
   aggcc    ug   - - u     u    ac  a 
5'      uggg  uag g c ggagc gagg  ug g
        ||||  ||| | | ||||| ||||  || g
3'      accc  guc c g ccucg uucc  ac c
   --gac    gu   u a u     -    --  u 
Get sequence
Deep sequencing
43 reads, 0 reads per million, 33 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 57772289-57772352 [-]
antisense
OTTHUMT00000433302 ; KATNB1-005; intron 1
OTTHUMT00000433303 ; KATNB1-006; intron 1
OTTHUMT00000257343 ; KATNB1-001; intron 2
OTTHUMT00000433301 ; KATNB1-010; intron 2
OTTHUMT00000433298 ; KATNB1-002; intron 2
OTTHUMT00000433300 ; KATNB1-004; intron 2
OTTHUMT00000433299 ; KATNB1-003; intron 3
ENST00000569627 ; KATNB1-005; intron 1
ENST00000563127 ; KATNB1-006; intron 1
ENST00000379661 ; KATNB1-001; intron 2
ENST00000566726 ; KATNB1-010; intron 2
ENST00000566611 ; KATNB1-002; intron 2
ENST00000566785 ; KATNB1-004; intron 2
ENST00000562592 ; KATNB1-003; intron 3
Database links

Mature sequence hsa-miR-6772-5p

Accession MIMAT0027444
Sequence

6 - 

uggguguaggcuggagcugagg

 - 27

Get sequence
Deep sequencing10 reads, 10 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6772-3p

Accession MIMAT0027445
Sequence

41 - 

uugcuccugacucugugcccaca

 - 63

Get sequence
Deep sequencing20 reads, 16 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).