Stem-loop sequence mmu-mir-6481

AccessionMI0022051 (change log)
Symbol MGI:Mir6481
DescriptionMus musculus miR-6481 stem-loop
Stem-loop
   uugcccaaacuaaacuaauaggauuuaccuauuaacaaa  c     -aug       aaa 
5'                                        cu aggua    uaguguu   a
                                          || |||||    |||||||   a
3'                                        ga uucgu    gucacga   g
   -------------aaauaaaaauacccuauucacgggua  -     aaaa       gac 
Get sequence
Deep sequencing
317 reads, 0 reads per million, 48 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 99199344-99199453 [-]
antisense
OTTMUST00000015861 ; Wars2-003; intron 2
OTTMUST00000015865 ; Wars2-001; intron 2
OTTMUST00000015866 ; Wars2-002; intron 2
OTTMUST00000015867 ; Wars2-004; intron 2
ENSMUST00000126875 ; Wars2-004; intron 2
ENSMUST00000145650 ; Wars2-003; intron 2
ENSMUST00000135960 ; Wars2-002; intron 2
ENSMUST00000004343 ; Wars2-001; intron 2
Database links

Mature sequence mmu-miR-6481

Accession MIMAT0027339
Sequence

69 - 

cacugaaaaugcuuagaug

 - 87

Get sequence
Deep sequencing253 reads, 41 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22844398 "Novel microRNAs differentially expressed during aging in the mouse brain" Inukai S, de Lencastre A, Turner M, Slack F PLoS One. 7:e40028(2012).