Stem-loop sequence hsa-mir-133a-1

Accession

MI0000450 (change log)

Symbol

HGNC:MIR133A1

Description

Homo sapiens miR-133a-1 stem-loop

Gene family

MIPF0000029; mir-133

Literature search

384 open access papers mention hsa-mir-133a-1
(1775 sentences)

Stem-loop

   a      uuu    g       aa  u  a        gccuc 
5'  caaugc   gcua agcuggu  aa gg accaaauc     u
    ||||||   |||| |||||||  || || ||||||||      
3'  guuacg   cgau ucgacca  uu cc ugguuuag     u
   a      uau    g       ac  c  c        guaac 

Deep sequencing

296052 reads, 543 reads per million, 143 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr18: 21825698-21825785 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000254903 ; OSBPL1A-002; intron 1

  OTTHUMT00000446405 ; OSBPL1A-015; intron 1

  OTTHUMT00000446434 ; OSBPL1A-016; intron 1

  OTTHUMT00000446357 ; OSBPL1A-003; intron 3

  OTTHUMT00000446406 ; OSBPL1A-014; intron 4

  OTTHUMT00000254902 ; OSBPL1A-001; intron 15

  ENST00000399443 ; OSBPL1A-002; intron 1

  ENST00000578055 ; OSBPL1A-015; intron 1

  ENST00000585247 ; OSBPL1A-016; intron 1

  ENST00000357041 ; OSBPL1A-003; intron 3

  ENST00000584119 ; OSBPL1A-014; intron 4

  ENST00000319481 ; OSBPL1A-001; intron 15

Clustered miRNAs

< 10kb from hsa-mir-133a-1

• hsa-mir-1-2: chr18: 21829004-21829088 [-]
• hsa-mir-133a-1: chr18: 21825698-21825785 [-]

Database links

• EntrezGene:MIR133A1
• HGNC:MIR133A1
• RNAcentral:URS00005EB596_9606
• miRBase Tracker:MI0000450

Mature sequence hsa-miR-133a-5p

• Accession: MIMAT0026478
• Sequence: 16 - agcugguaaaauggaaccaaau - 37
• Deep sequencing: 17566 reads, 117 experiments
• Evidence: experimental; Illumina [3]
• Database links:
  • RNAcentral:URS0000383E7F_9606
• Predicted targets:
  • TargetScanVert:hsa-miR-133a-5p
  • miRDB:hsa-miR-133a-5p

Mature sequence hsa-miR-133a-3p

• Accession: MIMAT0000427
• Sequence: 53 - uuugguccccuucaaccagcug - 74
• Deep sequencing: 574422 reads, 143 experiments
• Evidence: experimental; cloned [2], Illumina [3]
• Database links:
  • RNAcentral:URS00004C9052_9606
• Predicted targets:
  • TargetScanVert:hsa-miR-133a-3p.2
  • miRDB:hsa-miR-133a-3p
  • microrna.org:hsa-miR-133a-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).