Stem-loop sequence mmu-mir-6413

AccessionMI0021950 (change log)
Symbol MGI:Mir6413
DescriptionMus musculus miR-6413 stem-loop
Stem-loop
   c    u -   cc  u     uc   gc  a    -      auuaca  -   ac 
5'  caag g aag  cu gccug  cuu  cu aguu ucucuc      cu aag  u
    |||| | |||  || |||||  |||  || |||| ||||||      || |||   
3'  guuc c uuc  ga uggac  gaa  ga ucgg agagag      ga uuc  c
   a    u g   au  -     ga   --  c    u      gucaca  g   au 
Get sequence
Deep sequencing
2478 reads, 3.26 reads per million, 92 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 20297581-20297688 [-]
intergenic
Database links

Mature sequence mmu-miR-6413

Accession MIMAT0025166
Sequence

76 - 

uggcucagaagagcagguagu

 - 96

Get sequence
Deep sequencing332 reads, 59 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).