Stem-loop sequence mmu-mir-6410

AccessionMI0021947 (change log)
Symbol MGI:Mir6410
DescriptionMus musculus miR-6410 stem-loop
Stem-loop
       -u   u  -      a   u  ---           c  ugu ug aagg 
5' gucu  ggc ca gggacu cuc gu   gcuccugggga cu   u  g    a
   ||||  ||| || |||||| ||| ||   ||||||||||| ||   |  |     
3' cagg  ccg gu ccuuga gag cg   uggggaccucu ga   a  u    a
       uc   -  a      g   c  gga           u  ucu gu gugu 
Get sequence
Deep sequencing
7 reads, 60 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 78434799-78434902 [+]
intergenic
Database links

Mature sequence mmu-miR-6410

Accession MIMAT0025163
Sequence

5 - 

uggcucagggacuacucugugc

 - 26

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).