Stem-loop sequence mmu-mir-6397

AccessionMI0021933 (change log)
Symbol MGI:Mir6397
DescriptionMus musculus miR-6397 stem-loop
Stem-loop
   -       --cucc    aau  u         aa   u   ua   a 
5'  gcagucu      cuca   uc cacugaaag  ucc gga  ugc u
    |||||||      ||||   || |||||||||  ||| |||  ||| g
3'  cgucgga      gagu   ag gugacuuuc  agg cuu  gcg a
   u       aaaucu    --g  -         ag   u   ua   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 108087357-108087449 [+]
antisense
OTTMUST00000021547 ; Scp2-003; intron 4
OTTMUST00000021546 ; Scp2-002; intron 7
OTTMUST00000021471 ; Scp2-001; intron 8
ENSMUST00000044248 ; Podn-201; intron 1
ENSMUST00000135379 ; Scp2-003; intron 4
ENSMUST00000149106 ; Scp2-002; intron 7
ENSMUST00000030340 ; Scp2-001; intron 8
Database links

Mature sequence mmu-miR-6397

Accession MIMAT0025149
Sequence

58 - 

uggagacuuucaguggaguga

 - 78

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).