Stem-loop sequence mmu-mir-1957b

AccessionMI0021929 (change log)
Symbol MGI:Mir1957b
DescriptionMus musculus miR-1957b stem-loop
Gene family MIPF0001592; mir-1957
Stem-loop
   a       -----   -   aag     ---            augua        g a  -  -    c 
5'  acauaua     cau cuu   uuucu   uauggggcugga     acucagug u ug gc ugcu a
    |||||||     ||| |||   |||||   ||||||||||||     |||||||| | || || ||||  
3'  uguauau     gua gaa   aaaga   augucccgaccu     ugagucgc g ac ug auga c
   c       aaguc   a   ---     acc            -----        g a  g  u    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mmu-miR-1957b

Accession MIMAT0025145
Sequence

31 - 

uggaauguaacucagugguau

 - 51

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).