Stem-loop sequence mmu-mir-6387

AccessionMI0021919 (change log)
Symbol MGI:Mir6387
DescriptionMus musculus miR-6387 stem-loop
Stem-loop
   a  a      u  a g  g    --      ---c     uaucc    -     agu 
5'  ga ugacac cc g ug aaug  gcuucc    uugug     ggug gccuc   g
    || |||||| || | || ||||  ||||||    |||||     |||| |||||   a
3'  cu auugug gg u ac uuac  cggagg    aacac     ccgu uggag   g
   a  c      u  g g  g    cu      ccgu     -----    g     acu 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 15800994-15801101 [-]
sense
OTTMUST00000068228 ; Trib2-001; intron 2
ENSMUST00000020922 ; Trib2-001; intron 2
Database links

Mature sequence mmu-miR-6387

Accession MIMAT0025134
Sequence

17 - 

uggaauggcuucccuuguguau

 - 38

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).