Stem-loop sequence rno-mir-6334

AccessionMI0021860 (change log)
DescriptionRattus norvegicus miR-6334 stem-loop
Stem-loop 
   ---c        ---   u  -aa    a  c    aac     aa      ua 
5'     uucuguca   ccc gg   gcag cu ggga   agccu  gcacug  a
       ||||||||   ||| ||   |||| || ||||   |||||  ||||||  u
3'     aggguagu   ggg uc   cguc ga cccu   ucgga  cgugau  c
   ccga        cua   u  ggc    -  -    --c     -c      ca
Get sequence
Deep sequencing
11 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr3: 150911586-150911684 [-]
antisense
ENSRNOT00000055310 ; TP53INP2-201; intron 1
Database links

Mature sequence rno-miR-6334

Accession MIMAT0025075
Sequence

58 -  

ccaggcucucccagcugccggc

 - 79

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).