Stem-loop sequence rno-mir-344g

AccessionMI0021837 (change log)
DescriptionRattus norvegicus miR-344g stem-loop
Gene family MIPF0000267; mir-344
Literature search

7 open access papers mention rno-mir-344g
(16 sentences)

Stem-loop 
   aauuuc  u                a     ------     u 
5'       ug cagucaggcuccuggc ggagu      ccagc c
         || |||||||||||||||| |||||      ||||| u
3'       ac gucaguucggggaccg ucucg      ggucg c
   ---cga  -                a     gaccuu     a
Get sequence
Deep sequencing
454 reads, 0 reads per million, 72 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 122409917-122409995 [-]
intergenic
Database links

Mature sequence rno-miR-344g

Accession MIMAT0025052
Sequence

11 -  

agucaggcuccuggcaggaguc

 - 32

Get sequence
Deep sequencing78 reads, 41 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).