Stem-loop sequence rno-mir-6314

AccessionMI0021832 (change log)
DescriptionRattus norvegicus miR-6314 stem-loop
Literature search

1 open access papers mention rno-mir-6314
(1 sentences)

Stem-loop 
   gucuuugccugcuucggaggugaugcug     cg   -a a      --     au    ---ug       gg 
5'                             ggcua  ucc  g ggcacu  gacag  cuga     gugauuu  u
                               |||||  |||  | ||||||  |||||  ||||     |||||||   
3'                             ccggu  agg  c ccguga  cuguc  gacu     cgcugga  a
   ------uguguugguaacucugguguca     ua   gg -      ca     cg    uccga       au
Get sequence
Deep sequencing
524 reads, 0 reads per million, 73 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr2: 211682675-211682813 [+]
antisense
ENSRNOT00000027690 ; Fndc7-201; exon 3
Database links

Mature sequence rno-miR-6314

Accession MIMAT0025047
Sequence

41 -  

aggcacugacagaucugauggu

 - 62

Get sequence
Deep sequencing514 reads, 65 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).