Stem-loop sequence rno-mir-3068

AccessionMI0021534 (change log)
DescriptionRattus norvegicus miR-3068 stem-loop
Gene family MIPF0001596; mir-3068
Literature search

2 open access papers mention rno-mir-3068
(8 sentences)

Stem-loop 
   a     aa       uca     g   uaa      uaa 
5'  agagu  uuggagu   ugcaa uuc   ccaguu   c
    |||||  |||||||   ||||| |||   ||||||    
3'  ucuua  aaccuca   acguu aag   ggucga   c
   g     -c       -ug     -   -ug      uga
Get sequence
Deep sequencing
133481 reads, 33.5 reads per million, 493 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 111468732-111468807 [-]
sense
ENSRNOT00000016389 ; Alkbh1-201; intron 3
Database links

Mature sequence rno-miR-3068-5p

Accession MIMAT0024845
Sequence

9 -  

uuggaguucaugcaaguucuaacca

 - 33

Get sequence
Deep sequencing8296 reads, 429 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence rno-miR-3068-3p

Accession MIMAT0024846
Sequence

50 -  

ggugaauugcaguacuccaaca

 - 71

Get sequence
Deep sequencing125173 reads, 492 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:22470567 "Discovery of novel microRNAs in rat kidney using next generation sequencing and microarray validation" Meng F, Hackenberg M, Li Z, Yan J, Chen T PLoS One. 7:e34394(2012).
2
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
3
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).