Stem-loop sequence hsa-mir-6075

AccessionMI0020352 (change log)
Symbol HGNC:MIR6075
DescriptionHomo sapiens miR-6075 stem-loop
Stem-loop 
   ---       c     -   cca    -  --c    -c  cca  u   gu 
5'    gacacca augcu ccu   ggcc ug   cugc  cu   gg cau  u
      ||||||| ||||| |||   |||| ||   ||||  ||   || |||   
3'    cuguggu uacgg gga   ccgg ac   gacg  ga   cc gug  c
   cca       -     c   --c    c  cac    ua  cac  u   ac
Get sequence
Deep sequencing
14 reads, 25 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 1510762-1510856 [-]
sense
OTTHUMT00000253651 ; LPCAT1-001; intron 1
OTTHUMT00000304032 ; LPCAT1-002; intron 1
OTTHUMT00000365913 ; LPCAT1-004; intron 2
ENST00000475622 ; LPCAT1-001; intron 1
ENST00000283415 ; LPCAT1-002; intron 1
ENST00000514484 ; LPCAT1-004; intron 2
Database links

Mature sequence hsa-miR-6075

Accession MIMAT0023700
Sequence

70 -  

acggcccaggcggcauuggug

 - 90

Get sequence
Deep sequencing6 reads, 5 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).