![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4750 |
|||||
Accession | MI0017389 (change log) | ||||
Symbol | HGNC:MIR4750 | ||||
Description | Homo sapiens miR-4750 stem-loop | ||||
Literature search |
1 open access papers mention hsa-mir-4750 | ||||
Stem-loop |
cg - c a - ga g 5' cu cggg gg ggugg uu gugcc a || |||| || ||||| || ||||| 3' ga gccc cc ccacc ag cgcgg c -- c u c c uc u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-4750-5p |
|
Accession | MIMAT0019887 |
Previous IDs | hsa-miR-4750 |
Sequence |
3 - cucgggcggaggugguugagug - 24 |
Deep sequencing | 202 reads, 57 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-4750-3p |
|
Accession | MIMAT0022979 |
Sequence |
35 - ccugacccacccccucccgcag - 56 |
Deep sequencing | 13 reads, 10 experiments |
Evidence | not experimental |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|