Stem-loop sequence hsa-mir-376c

AccessionMI0000776 (change log)
Previous IDshsa-mir-368
Symbol HGNC:MIR376C
DescriptionHomo sapiens miR-376c stem-loop
Gene family MIPF0000091; mir-368
Literature search

80 open access papers mention hsa-mir-376c
(320 sentences)

Stem-loop 
       g     ua     u         uguua 
5' aaaa gugga  uuccu cuauguuua     u
   |||| |||||  ||||| |||||||||     u
3' uuuu caccu  aagga gauacaaau     u
       g     ua     -         uggua
Get sequence
Deep sequencing
34182 reads, 214 reads per million, 132 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA has been named both miR-368 and miR376c in the literature, and previously here. The mature miR-376c product has been shown to be modified by A to I edits [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101039690-101039755 [+]
antisense
OTTHUMT00000414335 ; BEGAIN-006; intron 1
ENST00000554140 ; BEGAIN-006; intron 1
Clustered miRNAs
< 10kb from hsa-mir-376c
hsa-mir-1193chr14: 101030052-101030129 [+]
hsa-mir-543chr14: 101031987-101032064 [+]
hsa-mir-495chr14: 101033755-101033836 [+]
hsa-mir-376cchr14: 101039690-101039755 [+]
hsa-mir-376a-2chr14: 101040069-101040148 [+]
hsa-mir-654chr14: 101040219-101040299 [+]
hsa-mir-376bchr14: 101040436-101040535 [+]
hsa-mir-376a-1chr14: 101040782-101040849 [+]
hsa-mir-300chr14: 101041363-101041445 [+]
hsa-mir-1185-1chr14: 101042977-101043062 [+]
hsa-mir-1185-2chr14: 101044198-101044283 [+]
hsa-mir-381chr14: 101045920-101045994 [+]
hsa-mir-487bchr14: 101046455-101046538 [+]
hsa-mir-539chr14: 101047321-101047398 [+]
hsa-mir-889chr14: 101047901-101047979 [+]
hsa-mir-544achr14: 101048658-101048748 [+]
hsa-mir-655chr14: 101049550-101049646 [+]
Database links

Mature sequence hsa-miR-376c-5p

Accession MIMAT0022861
Sequence

5 -  

gguggauauuccuucuauguu

 - 25

Get sequence
Deep sequencing842 reads, 98 experiments
Evidence experimental; SOLiD [5]
Database links
Predicted targets

Mature sequence hsa-miR-376c-3p

Accession MIMAT0000720
Previous IDshsa-miR-368;hsa-miR-376c
Sequence

43 -  

aacauagaggaaauuccacgu

 - 63

Get sequence
Deep sequencing33338 reads, 132 experiments
Evidence experimental; cloned [1-2,4], Northern [1], SOLiD [5]
Database links
Predicted targets

References

1
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
2
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
3
PMID:17322061 "Redirection of silencing targets by adenosine-to-inosine editing of miRNAs" Kawahara Y, Zinshteyn B, Sethupathy P, Iizasa H, Hatzigeorgiou AG, Nishikura K Science. 315:1137-1140(2007).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).