Stem-loop sequence mmu-mir-5615-1

AccessionMI0019181 (change log)
Symbol MGI:Mir5615-1
DescriptionMus musculus miR-5615-1 stem-loop
Gene family MIPF0001318; mir-5615
Stem-loop
   --                         gag 
5'   cuugguuguuuucugagacagaaaa   u
     |||||||||||||||||||||||||    
3'   gaaccaacaaaagacucugucuuuu   c
   ag                         acu 
Get sequence
Deep sequencing
295 reads, 0 reads per million, 53 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 81104614-81104673 [-]
antisense
ENSMUST00000176537 ; Gm23367-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-5615-1
mmu-mir-5615-2chr10: 81104616-81104675 [+]
mmu-mir-5615-1chr10: 81104614-81104673 [-]
Database links

Mature sequence mmu-miR-5615-5p

Accession MIMAT0022355
Sequence

1 - 

cuugguuguuuucugagacaga

 - 22

Get sequence
Deep sequencing429 reads, 38 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence mmu-miR-5615-3p

Accession MIMAT0022356
Sequence

39 - 

ugucucagaaaacaaccaagga

 - 60

Get sequence
Deep sequencing150 reads, 34 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).