Stem-loop sequence hsa-mir-4761

AccessionMI0017402 (change log)
Symbol HGNC:MIR4761
DescriptionHomo sapiens miR-4761 stem-loop
Literature search

1 open access papers mention hsa-mir-4761
(1 sentences)

Stem-loop 
                      ga  c   gu   a  u  aaa 
5' ggacaaggugugcaugccu  cc guu  cag cc gg   a
   |||||||||||||||||||  || |||  ||| || ||    
3' ccuguuucacgcguacggg  gg cgg  guc gg cc   a
                      ag  a   gu   -  -  ggg
Get sequence
Deep sequencing
160 reads, 8.11 reads per million, 37 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 19963753-19963834 [+]
antisense
OTTHUMT00000318878 ; ARVCF-002; intron 3
OTTHUMT00000319751 ; ARVCF-012; intron 7
OTTHUMT00000319752 ; ARVCF-013; intron 7
OTTHUMT00000319750 ; ARVCF-011; intron 8
OTTHUMT00000075314 ; ARVCF-001; intron 10
ENST00000495096 ; ARVCF-002; intron 3
ENST00000406522 ; ARVCF-012; intron 7
ENST00000406259 ; ARVCF-013; intron 7
ENST00000401994 ; ARVCF-011; intron 8
ENST00000344269 ; ARVCF-201; intron 8
ENST00000263207 ; ARVCF-001; intron 10
Database links

Mature sequence hsa-miR-4761-5p

Accession MIMAT0019908
Sequence

3 -  

acaaggugugcaugccugacc

 - 23

Get sequence
Deep sequencing79 reads, 22 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4761-3p

Accession MIMAT0019909
Sequence

62 -  

gagggcaugcgcacuuugucc

 - 82

Get sequence
Deep sequencing77 reads, 23 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).