Stem-loop sequence hsa-mir-4751

AccessionMI0017390 (change log)
Symbol HGNC:MIR4751
DescriptionHomo sapiens miR-4751 stem-loop
Stem-loop
   -c       ca       cgu    g       -g   g 
5'   ccggagc  gaggacc   agcu cuagaag  gca g
     |||||||  |||||||   |||| |||||||  |||  
3'   ggucucg  cuucugg   ucgg ggucuuc  ugu g
   gc       -a       ---    g       gg   g 
Get sequence
Deep sequencing
32 reads, 0 reads per million, 22 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 49933064-49933137 [+]
antisense
OTTHUMT00000465367 ; SLC17A7-001; 3'UTR (exon 12)
ENST00000221485 ; SLC17A7-001; 3'UTR (exon 12)
Database links

Mature sequence hsa-miR-4751

Accession MIMAT0019888
Sequence

10 - 

agaggacccguagcugcuagaagg

 - 33

Get sequence
Deep sequencing8 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).