Stem-loop sequence hsa-mir-4745

Accession

MI0017384 (change log)

Symbol

HGNC:MIR4745

Description

Homo sapiens miR-4745 stem-loop

Literature search

2 open access papers mention hsa-mir-4745
(2 sentences)

Stem-loop

   --guga       -  -     a   c   cg 
5'       guggggc uc ccggg cgg gcc  c
         ||||||| || ||||| ||| |||   
3'       cacucug ag ggccc guc cgg  c
   cccugg       c  c     g   c   uc 

Deep sequencing

245 reads, 0 reads per million, 42 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr19: 804940-805001 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000457611 ; PTBP1-008; exon 1

  OTTHUMT00000457612 ; PTBP1-010; intron 1

  OTTHUMT00000458199 ; PTBP1-014; intron 2

  OTTHUMT00000458202 ; PTBP1-016; intron 2

  OTTHUMT00000458200 ; PTBP1-018; intron 3

  OTTHUMT00000457603 ; PTBP1-001; intron 7

  OTTHUMT00000457605 ; PTBP1-003; intron 7

  OTTHUMT00000457606 ; PTBP1-004; intron 7

  OTTHUMT00000457608 ; PTBP1-002; intron 7

  ENST00000587136 ; PTBP1-008; exon 1

  ENST00000592804 ; PTBP1-010; intron 1

  ENST00000587191 ; PTBP1-014; intron 2

  ENST00000585956 ; PTBP1-016; intron 2

  ENST00000350092 ; PTBP1-201; intron 2

  ENST00000592113 ; PTBP1-018; intron 3

  ENST00000356948 ; PTBP1-001; intron 7

  ENST00000349038 ; PTBP1-003; intron 7

  ENST00000586944 ; PTBP1-004; intron 7

  ENST00000394601 ; PTBP1-002; intron 7

Clustered miRNAs

< 10kb from hsa-mir-4745

• hsa-mir-4745: chr19: 804940-805001 [+]
• hsa-mir-3187: chr19: 813584-813653 [+]

Database links

• EntrezGene:MIR4745
• HGNC:MIR4745
• RNAcentral:URS000075C987_9606
• miRBase Tracker:MI0017384

Mature sequence hsa-miR-4745-5p

• Accession: MIMAT0019878
• Sequence: 2 - ugaguggggcucccgggacggcg - 24
• Deep sequencing: 197 reads, 31 experiments
• Evidence: experimental; Illumina [1]
• Database links:
  • RNAcentral:URS00005485E8_9606
• Predicted targets:
  • TargetMiner:hsa-miR-4745-5p
  • TargetScanVert:hsa-miR-4745-5p
  • miRDB:hsa-miR-4745-5p

Mature sequence hsa-miR-4745-3p

• Accession: MIMAT0019879
• Sequence: 38 - uggcccggcgacgucucacgguc - 60
• Deep sequencing: 43 reads, 22 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4745-3p
  • TargetScanVert:hsa-miR-4745-3p
  • miRDB:hsa-miR-4745-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).