Stem-loop sequence hsa-mir-4697

AccessionMI0017330 (change log)
Symbol HGNC:MIR4697
DescriptionHomo sapiens miR-4697 stem-loop
Literature search

4 open access papers mention hsa-mir-4697
(7 sentences)

Stem-loop
        caga       - c                -  acc 
5' gggcc    agggggc g agucacugacgugaag gg   a
   |||||    ||||||| | |||||||||||||||| ||    
3' ucugg    uuccccg c ucagugacuguacuuc cc   c
        ----       u c                g  cua 
Get sequence
Deep sequencing
38 reads, 0 reads per million, 23 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 133898504-133898581 [-]
intergenic
Database links

Mature sequence hsa-miR-4697-5p

Accession MIMAT0019791
Sequence

10 - 

agggggcgcagucacugacgug

 - 31

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4697-3p

Accession MIMAT0019792
Sequence

53 - 

ugucagugacuccugccccuuggu

 - 76

Get sequence
Deep sequencing33 reads, 23 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).