![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4697 |
|||||
Accession | MI0017330 (change log) | ||||
Symbol | HGNC:MIR4697 | ||||
Description | Homo sapiens miR-4697 stem-loop | ||||
Literature search |
4 open access papers mention hsa-mir-4697 | ||||
Stem-loop |
caga - c - acc 5' gggcc agggggc g agucacugacgugaag gg a ||||| ||||||| | |||||||||||||||| || 3' ucugg uuccccg c ucagugacuguacuuc cc c ---- u c g cua |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4697-5p |
|
Accession | MIMAT0019791 |
Sequence |
10 - agggggcgcagucacugacgug - 31 |
Deep sequencing | 5 reads, 3 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
Mature sequence hsa-miR-4697-3p |
|
Accession | MIMAT0019792 |
Sequence |
53 - ugucagugacuccugccccuuggu - 76 |
Deep sequencing | 33 reads, 23 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|