Stem-loop sequence hsa-mir-4696

AccessionMI0017329 (change log)
Symbol HGNC:MIR4696
DescriptionHomo sapiens miR-4696 stem-loop
Stem-loop 
                   c     c        auu 
5' caaagccacugcaaga ggaua ugucaucu   c
   |||||||||||||||| ||||| ||||||||    
3' guuucggugacguuuu ccugu acaguaga   c
                   a     a        aga
Get sequence
Deep sequencing
15 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 74720268-74720337 [-]
antisense
OTTHUMT00000384597 ; NEU3-005; intron 3
ENST00000529024 ; NEU3-005; intron 3
Database links

Mature sequence hsa-miR-4696

Accession MIMAT0019790
Sequence

10 -  

ugcaagacggauacugucaucu

 - 31

Get sequence
Deep sequencing14 reads, 13 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).