Stem-loop sequence hsa-mir-4655

Accession

MI0017283 (change log)

Symbol

HGNC:MIR4655

Description

Homo sapiens miR-4655 stem-loop

Literature search

1 open access papers mention hsa-mir-4655
(3 sentences)

Stem-loop

      a    a a       --    a        uggg 
5' cca gggc c ccgggga  uggc gagggucg    a
   ||| |||| | |||||||  |||| ||||||||    a
3' ggu cccg g ggccccu  acug cucccagu    a
      c    a g       gg    -        ugug 

Deep sequencing

111 reads, 2.13 reads per million, 47 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr7: 1844180-1844253 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR4655
• HGNC:MIR4655
• miRBase Tracker:MI0017283

Mature sequence hsa-miR-4655-5p

• Accession: MIMAT0019721
• Sequence: 10 - caccggggauggcagagggucg - 31
• Deep sequencing: 42 reads, 18 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4655-5p
  • TargetScanVert:hsa-miR-4655-5p
  • miRDB:hsa-miR-4655-5p

Mature sequence hsa-miR-4655-3p

• Accession: MIMAT0019722
• Sequence: 45 - acccucgucagguccccgggg - 65
• Deep sequencing: 12 reads, 5 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4655-3p
  • TargetScanVert:hsa-miR-4655-3p
  • miRDB:hsa-miR-4655-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).