Stem-loop sequence mmu-mir-3968

AccessionMI0016977 (change log)
Symbol MGI:Mir3968
DescriptionMus musculus miR-3968 stem-loop
Literature search

3 open access papers mention mmu-mir-3968
(6 sentences)

Stem-loop
   ---acgccgagc  g   u   a    c   guag  ccg   g     u u 
5'             gu ugg ggu ggau cgu    ca   ucu ugugu g u
               || ||| ||| |||| |||    ||   ||| ||||| | g
3'             ca acc uca ccua gcg    gu   aga acaca c u
   ggaugaguacca  g   -   c    a   ---a  uca   g     c g 
Get sequence
Deep sequencing
14328 reads, 818 reads per million, 108 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 115447961-115448060 [-]
antisense
OTTMUST00000007261 ; RP23-392H19.2-001; 3'UTR (exon 8)
ENSMUST00000093914 ; 4933422H20Rik-001; 3'UTR (exon 8)
Database links

Mature sequence mmu-miR-3968

Accession MIMAT0019352
Sequence

72 - 

cgaaucccacuccagacacca

 - 92

Get sequence
Deep sequencing14280 reads, 101 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20935160 "Next-generation sequencing identifies the natural killer cell microRNA transcriptome" Fehniger TA, Wylie T, Germino E, Leong JW, Magrini VJ, Koul S, Keppel CR, Schneider SE, Koboldt DC, Sullivan RP, Heinz ME, Crosby SD, Nagarajan R, Ramsingh G, Link DC, Ley TJ, Mardis ER Genome Res. 20:1590-1604(2010).