Stem-loop sequence mmu-mir-3966

AccessionMI0016975 (change log)
Symbol MGI:Mir3966
DescriptionMus musculus miR-3966 stem-loop
Stem-loop
   aacac       ga a  u  c   -  ua    --u     u 
5'      aggaaaa  c gc gc agc ug  gaac   guuuu a
        |||||||  | || || ||| ||  ||||   ||||| a
3'      uucuuuu  g cg cg ucg ac  cuug   caaaa u
   -uuua       ga a  u  u   u  ua    ugu     u 
Get sequence
Deep sequencing
392 reads, 0 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 97423478-97423562 [+]
intergenic
Database links

Mature sequence mmu-miR-3966

Accession MIMAT0019350
Sequence

16 - 

agcugccagcuguagaacugu

 - 36

Get sequence
Deep sequencing389 reads, 27 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20935160 "Next-generation sequencing identifies the natural killer cell microRNA transcriptome" Fehniger TA, Wylie T, Germino E, Leong JW, Magrini VJ, Koul S, Keppel CR, Schneider SE, Koboldt DC, Sullivan RP, Heinz ME, Crosby SD, Nagarajan R, Ramsingh G, Link DC, Ley TJ, Mardis ER Genome Res. 20:1590-1604(2010).