![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-378h |
|||||
Accession | MI0016808 (change log) | ||||
Symbol | HGNC:MIR378H | ||||
Description | Homo sapiens miR-378h stem-loop | ||||
Literature search |
![]()
190 open access papers mention hsa-mir-378h | ||||
Stem-loop |
a gaac a ug u ------- ---u c 5' cag acugg cu g gucagau ggga gagc c ||| ||||| || | ||||||| |||| |||| 3' guc ugauc ga u uagucua uccu cucg u g --ac - gu c acgacga uugu g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-378h |
|
Accession | MIMAT0018984 |
Sequence |
9 - acuggacuuggugucagaugg - 29 |
Deep sequencing | 1651016 reads, 132 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|