Stem-loop sequence hsa-mir-3939

AccessionMI0016596 (change log)
Symbol HGNC:MIR3939
DescriptionHomo sapiens miR-3939 stem-loop
Stem-loop 
   --------c   cuuccaa     ucu     ---u      -a g  g          acc 
5'          ugg       aggcc   gugug    uccugu  u ug gcgugcacgu   u
            |||       |||||   |||||    ||||||  | || ||||||||||   g
3'          acc       uucgg   cacac    aggaca  a ac cgcaugugua   u
   ucuacacaa   -------     --u     cugu      cc g  g          cac
Get sequence
Deep sequencing
210 reads, 0 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 166997807-166997912 [-]
sense
OTTHUMT00000043075 ; RPS6KA2-001; intron 1
OTTHUMT00000362911 ; RPS6KA2-013; intron 1
OTTHUMT00000362908 ; RPS6KA2-010; intron 1
OTTHUMT00000362909 ; RPS6KA2-011; intron 1
OTTHUMT00000362910 ; RPS6KA2-012; intron 1
OTTHUMT00000043077 ; RPS6KA2-003; intron 2
OTTHUMT00000362836 ; RPS6KA2-005; intron 3
OTTHUMT00000362907 ; RPS6KA2-009; intron 4
ENST00000265678 ; RPS6KA2-001; intron 1
ENST00000507350 ; RPS6KA2-013; intron 1
ENST00000512860 ; RPS6KA2-010; intron 1
ENST00000507371 ; RPS6KA2-011; intron 1
ENST00000511034 ; RPS6KA2-012; intron 1
ENST00000366863 ; RPS6KA2-201; intron 1
ENST00000503859 ; RPS6KA2-003; intron 2
ENST00000510118 ; RPS6KA2-005; intron 3
ENST00000506565 ; RPS6KA2-009; intron 4
Database links

Mature sequence hsa-miR-3939

Accession MIMAT0018355
Sequence

62 -  

uacgcgcagaccacaggauguc

 - 83

Get sequence
Deep sequencing163 reads, 36 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20498841 "Deep sequencing of human nuclear and cytoplasmic small RNAs reveals an unexpectedly complex subcellular distribution of miRNAs and tRNA 3' trailers" Liao JY, Ma LM, Guo YH, Zhang YC, Zhou H, Shao P, Chen YQ, Qu LH PLoS One. 5:e10563(2010).