Stem-loop sequence hsa-mir-3691

Accession

MI0016092 (change log)

Symbol

HGNC:MIR3691

Description

Homo sapiens miR-3691 stem-loop

Literature search

1 open access papers mention hsa-mir-3691
(2 sentences)

Stem-loop

   u            u  u        g     c   a      gc 
5'  ugaggcacuggg ag ggaugaug agacu ggu cccacu  u
    |||||||||||| || |||||||| ||||| ||| ||||||   
3'  acuccgugacuc uc ccuacugc ucuga cca gggugg  g
   a            c  u        g     a   g      ga 

Deep sequencing

809 reads, 0 reads per million, 73 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr6: 5148233-5148322 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000353482 ; LYRM4-004; intron 1

  OTTHUMT00000353461 ; LYRM4-001; intron 2

  OTTHUMT00000353484 ; LYRM4-006; intron 2

  OTTHUMT00000353485 ; LYRM4-007; intron 2

  OTTHUMT00000353483 ; LYRM4-005; intron 2

  ENST00000468929 ; LYRM4-004; intron 1

  ENST00000330636 ; LYRM4-001; intron 2

  ENST00000464010 ; LYRM4-006; intron 2

  ENST00000463032 ; LYRM4-007; intron 2

  ENST00000480566 ; LYRM4-005; intron 2

Database links

• EntrezGene:MIR3691
• HGNC:MIR3691
• RNAcentral:URS000075D0E7_9606
• miRBase Tracker:MI0016092

Mature sequence hsa-miR-3691-5p

• Accession: MIMAT0018120
• Previous IDs: hsa-miR-3691
• Sequence: 15 - aguggaugauggagacucgguac - 37
• Deep sequencing: 760 reads, 69 experiments
• Evidence: experimental; Illumina [1-2]
• Database links:
  • RNAcentral:URS00000393C7_9606
• Predicted targets:
  • TargetMiner:hsa-miR-3691-5p
  • TargetScanVert:hsa-miR-3691-5p
  • miRDB:hsa-miR-3691-5p

Mature sequence hsa-miR-3691-3p

• Accession: MIMAT0019224
• Sequence: 56 - accaagucugcgucauccucuc - 77
• Deep sequencing: 43 reads, 23 experiments
• Evidence: experimental; Illumina [2]
• Predicted targets:
  • TargetMiner:hsa-miR-3691-3p
  • TargetScanVert:hsa-miR-3691-3p
  • miRDB:hsa-miR-3691-3p

References

1. PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).
2. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).