Stem-loop sequence hsa-mir-3651

Accession

MI0016051 (change log)

Symbol

HGNC:MIR3651

Description

Homo sapiens miR-3651 stem-loop

Literature search

2 open access papers mention hsa-mir-3651
(3 sentences)

Stem-loop

     u  g   gg   uagcaauccu      uau  -    a       uc 
5' ga uc aug  cca          gugauu   gc augg ggcugcu  u
   || || |||  |||          ||||||   || |||| |||||||  c
3' cu ag uac  ggu          cgcugg   cg uacc ucgacga  c
     u  -   au   ----------      -cc  a    g       cu 

Deep sequencing

671 reads, 3.37 reads per million, 89 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr9: 92292458-92292547 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR3651
• HGNC:MIR3651
• RNAcentral:URS000075DEE5_9606
• miRBase Tracker:MI0016051

Mature sequence hsa-miR-3651

• Accession: MIMAT0018071
• Sequence: 64 - cauagcccggucgcugguacauga - 87
• Deep sequencing: 634 reads, 82 experiments
• Evidence: experimental; 454 [1]
• Database links:
  • RNAcentral:URS0000299AD8_9606
• Predicted targets:
  • TargetMiner:hsa-miR-3651
  • TargetScanVert:hsa-miR-3651
  • miRDB:hsa-miR-3651

References

1. PMID:20483914 "Discovery of microRNAs and other small RNAs in solid tumors" Meiri E, Levy A, Benjamin H, Ben-David M, Cohen L, Dov A, Dromi N, Elyakim E, Yerushalmi N, Zion O, Lithwick-Yanai G, Sitbon E Nucleic Acids Res. 38:6234-6246(2010).