Stem-loop sequence rno-mir-3542-1

AccessionMI0015396 (change log)
Previous IDsrno-mir-3542
DescriptionRattus norvegicus miR-3542-1 stem-loop
Gene family MIPF0002110; mir-3542
Stem-loop
   c    agaaa   -aga   aug          u     a    ag    ---a      agg 
5'  cuga     ucg    acu   guagggagag ggggc uugg  cugc    cagagg   g
    ||||     |||    |||   |||||||||| ||||| ||||  ||||    ||||||   u
3'  ggcu     agc    uga   cguuccuuuc ucucg aacc  gaug    gucucc   c
   -    ----a   cacg   ---          u     g    aa    gugg      gga 
Get sequence
Deep sequencing
404 reads, 0 reads per million, 173 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr17: 9370865-9370981 [+]
antisense
ENSRNOT00000000146 ; Txndc15-201; intron 3
Database links

Mature sequence rno-miR-3542

Accession MIMAT0017796
Sequence

84 - 

aaggcucuucuuuccuugcag

 - 104

Get sequence
Deep sequencing772 reads, 168 experiments
Evidence experimental; SOLiD [1]

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).