Stem-loop sequence rno-mir-652

AccessionMI0006169 (change log)
DescriptionRattus norvegicus miR-652 stem-loop
Gene family MIPF0000333; mir-652
Literature search

7 open access papers mention rno-mir-652
(9 sentences)

Stem-loop 
   --a                  gaggg           ca  g 
5'    ugcacugcacaacccuag     ggugccauuca  ua a
      ||||||||||||||||||     |||||||||||  || c
3'    augugacguguugggauc     ccgcgguaagu  au u
   aac                  ----a           ua  a
Get sequence
Deep sequencing
106237 reads, 34.9 reads per million, 493 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The predominant miRNA cloned by Landgraf et al. has a 3' additional U residue, which is incompatible with the genome sequence [1].

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 114002534-114002614 [+]
sense
ENSRNOT00000068431 ; Tmem164-201; intron 1
Database links

Mature sequence rno-miR-652-5p

Accession MIMAT0017321
Previous IDsrno-miR-652*
Sequence

10 -  

acaacccuaggagggggugccau

 - 32

Get sequence
Deep sequencing906 reads, 268 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-652-3p

Accession MIMAT0005342
Previous IDsrno-miR-652
Sequence

51 -  

aauggcgccacuaggguugug

 - 71

Get sequence
Deep sequencing105330 reads, 493 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).