![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-494 |
||||||||||||||||||||||||||||||||||||||||||||
Accession | MI0003532 (change log) | |||||||||||||||||||||||||||||||||||||||||||
Symbol | MGI:Mir494 | |||||||||||||||||||||||||||||||||||||||||||
Description | Mus musculus miR-494 stem-loop | |||||||||||||||||||||||||||||||||||||||||||
Gene family | MIPF0000018; mir-154 | |||||||||||||||||||||||||||||||||||||||||||
Literature search |
![]()
67 open access papers mention mmu-mir-494 | |||||||||||||||||||||||||||||||||||||||||||
Stem-loop |
u u gu - c - uuu 5' ugauacu gaaggagagguu ccgugu ugu uuc uc a ||||||| |||||||||||| |||||| ||| ||| || u 3' acuauga uuuuuucuccaa ggcaca aca aag ag u a - ag u - u uau |
|||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||||||||||||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. |
|||||||||||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-494-5p |
|
Accession | MIMAT0017215 |
Previous IDs | mmu-miR-494* |
Sequence |
17 - agguuguccguguugucuucuc - 38 |
Deep sequencing | 258 reads, 33 experiments |
Evidence | experimental; Illumina [5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-494-3p |
|
Accession | MIMAT0003182 |
Previous IDs | mmu-miR-494 |
Sequence |
50 - ugaaacauacacgggaaaccuc - 71 |
Deep sequencing | 17929 reads, 82 experiments |
Evidence | experimental; cloned [1,3], MPSS [2], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
2 |
PMID:16582102
"The expression profile of microRNAs in mouse embryos"
Nucleic Acids Res. 34:1765-1771(2006).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|