![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-489 |
||||||
Accession | MI0003477 (change log) | |||||
Description | Rattus norvegicus miR-489 stem-loop | |||||
Gene family | MIPF0000111; mir-489 | |||||
Literature search |
![]()
5 open access papers mention rno-mir-489 | |||||
Stem-loop |
----acugcuaca c c aca c ug 5' guggcag uugguugucguaug gugaug cguucu g u ||||||| |||||||||||||| |||||| |||||| | 3' cauuguc aaucgacgguauau cacuac guaaga c a ugaacaacaagga a a --a c uu |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence rno-miR-489-5p |
|
Accession | MIMAT0017196 |
Previous IDs | rno-miR-489* |
Sequence |
23 - ugucguaugcgugaugacacguuc - 46 |
Deep sequencing | 350 reads, 99 experiments |
Evidence | experimental; SOLiD [2] |
Predicted targets |
|
Mature sequence rno-miR-489-3p |
|
Accession | MIMAT0003113 |
Previous IDs | rno-miR-489 |
Sequence |
61 - augacaucacauauauggcagc - 82 |
Deep sequencing | 7857 reads, 254 experiments |
Evidence | experimental; SOLiD [2] |
Predicted targets |
|
References |
|
1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
2 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|