Stem-loop sequence rno-mir-186

Accession

MI0000931 (change log)

Description

Rattus norvegicus miR-186 stem-loop

Gene family

MIPF0000109; mir-186

Literature search

15 open access papers mention rno-mir-186
(102 sentences)

Stem-loop

   u     c                 u     u      ucucau 
5'  gcuua aacuuuccaaagaauuc ccuuu gggcuu      u
    ||||| ||||||||||||||||| ||||| ||||||       
3'  cgagu uugaaggguuuuuuaag ggaaa cccgaa      u
   u     -                 u     -      uuuuau 

Deep sequencing

2226009 reads, 1.73e+03 reads per million, 510 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr2: 263873759-263873844 [+]
• Overlapping transcripts:

  sense

  ENSRNOT00000055259 ; Zranb2-201; intron 8

Database links

• EntrezGene:Mir186
• miRBase Tracker:MI0000931

Mature sequence rno-miR-186-5p

• Accession: MIMAT0000863
• Previous IDs: rno-miR-186
• Sequence: 15 - caaagaauucuccuuuugggcu - 36
• Deep sequencing: 2225812 reads, 510 experiments
• Evidence: experimental; cloned [1-3], SOLiD [4]
• Predicted targets:
  • TargetScanVert:rno-miR-186-5p
  • miRDB:rno-miR-186-5p
  • microrna.org:rno-miR-186-5p

Mature sequence rno-miR-186-3p

• Accession: MIMAT0017143
• Previous IDs: rno-miR-186*
• Sequence: 54 - gcccaaaggugaauuuuuugg - 74
• Deep sequencing: 195 reads, 133 experiments
• Evidence: experimental; SOLiD [4]
• Predicted targets:
  • TargetScanVert:rno-miR-186-3p
  • miRDB:rno-miR-186-3p

References

1. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
4. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).