![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-150 |
|||||
Accession | MI0000920 (change log) | ||||
Description | Rattus norvegicus miR-150 stem-loop | ||||
Gene family | MIPF0000197; mir-150 | ||||
Literature search |
![]()
34 open access papers mention rno-mir-150 | ||||
Stem-loop |
c g ac u u - u 5' uucucaag cccugucuccca ccu guaccag g cug g |||||||| |||||||||||| ||| ||||||| | ||| c 3' agggguuc gggacagggggu gga caugguc c gac c c a cc - c a u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence rno-miR-150-5p |
|
Accession | MIMAT0000853 |
Previous IDs | rno-miR-150 |
Sequence |
16 - ucucccaacccuuguaccagug - 37 |
Deep sequencing | 659094 reads, 490 experiments |
Evidence | experimental; cloned [1-3], SOLiD [4] |
Predicted targets |
|
Mature sequence rno-miR-150-3p |
|
Accession | MIMAT0017133 |
Previous IDs | rno-miR-150* |
Sequence |
52 - cugguacaggccuggggga - 70 |
Deep sequencing | 2191 reads, 343 experiments |
Evidence | experimental; SOLiD [4] |
Predicted targets |
|
References |
|
1 |
PMID:15345052
"Microarray analysis of microRNA expression in the developing mammalian brain"
Genome Biol. 5:R68(2004).
|
2 | |
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|