Stem-loop sequence rno-mir-145

Accession

MI0000918 (change log)

Description

Rattus norvegicus miR-145 stem-loop

Gene family

MIPF0000079; mir-145

Literature search

80 open access papers mention rno-mir-145
(703 sentences)

Stem-loop

   ca  u  u     c  uc    u  c            uggau 
5'   cc ug ccuca gg  cagu uu ccaggaaucccu     g
     || || ||||| ||  |||| || ||||||||||||     c
3'   gg ac ggagu uc  guca aa gguccuuagggg     u
   uc  u  u     -  uu    u  a            uagaa 

Deep sequencing

1201260 reads, 740 reads per million, 485 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr18: 56969907-56969994 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from rno-mir-145

• rno-mir-143: chr18: 56971273-56971377 [-]
• rno-mir-145: chr18: 56969907-56969994 [-]

Database links

• EntrezGene:Mir145
• miRBase Tracker:MI0000918

Mature sequence rno-miR-145-5p

• Accession: MIMAT0000851
• Previous IDs: rno-miR-145
• Sequence: 16 - guccaguuuucccaggaaucccu - 38
• Deep sequencing: 868093 reads, 485 experiments
• Evidence: experimental; cloned [1-3], SOLiD [4]
• Predicted targets:
  • TargetScanVert:rno-miR-145-5p
  • miRDB:rno-miR-145-5p
  • microrna.org:rno-miR-145-5p

Mature sequence rno-miR-145-3p

• Accession: MIMAT0017131
• Previous IDs: rno-miR-145*
• Sequence: 54 - ggauuccuggaaauacuguuc - 74
• Deep sequencing: 332540 reads, 480 experiments
• Evidence: experimental; SOLiD [4]
• Predicted targets:
  • TargetScanVert:rno-miR-145-3p
  • miRDB:rno-miR-145-3p

References

1. PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).