Stem-loop sequence rno-mir-129-1

AccessionMI0000902 (change log)
DescriptionRattus norvegicus miR-129-1 stem-loop
Gene family MIPF0000073; mir-129
Literature search

29 open access papers mention rno-mir-129-1
(156 sentences)

Stem-loop 
   u    -       c   cu      g   uu  -  c 
5'  gggu cuuuuug ggu  gggcuu cug  cu cu c
    |||| ||||||| |||  |||||| |||  || ||  
3'  ucua gaaaaac cca  cccgaa gac  ga ga a
   -    u       c   uu      g   -u  u  c
Get sequence
Deep sequencing
329845 reads, 223 reads per million, 425 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr4: 56301726-56301797 [+]
intergenic
Database links

Mature sequence rno-miR-129-5p

Accession MIMAT0000600
Previous IDsrno-miR-129
Sequence

6 -  

cuuuuugcggucugggcuugc

 - 26

Get sequence
Deep sequencing318388 reads, 399 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-129-1-3p

Accession MIMAT0017120
Previous IDsrno-miR-129-1*
Sequence

49 -  

aagcccuuaccccaaaaag

 - 67

Get sequence
Deep sequencing170500 reads, 392 experiments
Evidence experimental; SOLiD [3]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).