Stem-loop sequence rno-mir-128-2

Accession

MI0000901 (change log)

Previous IDs

rno-mir-128b

Description

Rattus norvegicus miR-128-2 stem-loop

Gene family

MIPF0000048; mir-128

Literature search

17 open access papers mention rno-mir-128-2
(63 sentences)

Stem-loop

   u ug       a          aug      aa    g gag 
5'  g  caguggg aggggggccg   cacugu  gaga u   u
    |  ||||||| ||||||||||   ||||||  |||| |    
3'  u  gucaucc uuucucuggc   gugaca  cucu g   a
   c gu       c          caa      --    g acg 

Deep sequencing

4437615 reads, 2.97e+03 reads per million, 495 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The most commonly cloned mature sequences derived from the previously annotated mir-128a and mir-128b were shown by Landgraf et al to be identical [3]. The sequences are therefore renamed mir-128-1 and mir-128-2.

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr8: 120378945-120379028 [-]
• Overlapping transcripts:

  sense

  ENSRNOT00000042854 ; Arpp21-201; intron 17

Database links

• EntrezGene:Mir128-2
• miRBase Tracker:MI0000901

Mature sequence rno-miR-128-2-5p

• Accession: MIMAT0017119
• Previous IDs: rno-miR-128-2*
• Sequence: 15 - gggggccgaugcacuguaaga - 35
• Deep sequencing: 1661 reads, 135 experiments
• Evidence: experimental; SOLiD [5]
• Predicted targets:
  • TargetScanVert:rno-miR-128-2-5p
  • miRDB:rno-miR-128-2-5p

Mature sequence rno-miR-128-3p

• Accession: MIMAT0000834
• Previous IDs: rno-miR-128a;rno-miR-128
• Sequence: 52 - ucacagugaaccggucucuuu - 72
• Deep sequencing: 8895221 reads, 495 experiments
• Evidence: experimental; cloned [1-4], Northern [1], SOLiD [5]
• Predicted targets:
  • TargetScanVert:rno-miR-128-3p
  • miRDB:rno-miR-128-3p
  • microrna.org:rno-miR-128-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
5. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).