Stem-loop sequence rno-mir-103-1

Accession

MI0000888 (change log)

Description

Rattus norvegicus miR-103-1 stem-loop

Gene family

MIPF0000024; mir-103

Literature search

32 open access papers mention rno-mir-103-1
(126 sentences)

Stem-loop

   u     c    c  --    u  u           c   u g a 
5'  ucuua ugcc uc  ggcu cu uacagugcugc uug u c u
    ||||| |||| ||  |||| || ||||||||||| ||| | |  
3'  agagu acgg ag  ucgg ga auguuacgacg aac a g a
   c     u    a  ua    -  c           -   u g u 

Deep sequencing

2029435 reads, 1.45e+03 reads per million, 509 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr10: 20606715-20606800 [+]
• Overlapping transcripts:

  sense

  ENSRNOT00000059780 ; Pank3-201; intron 5

Database links

• EntrezGene:Mir103-1
• miRBase Tracker:MI0000888

Mature sequence rno-miR-103-1-5p

• Accession: MIMAT0017114
• Previous IDs: rno-miR-103-1*
• Sequence: 15 - ggcuucuuuacagugcugccuugu - 38
• Deep sequencing: 293 reads, 151 experiments
• Evidence: experimental; SOLiD [5]
• Predicted targets:
  • TargetScanVert:rno-miR-103-1-5p
  • miRDB:rno-miR-103-1-5p

Mature sequence rno-miR-103-3p

• Accession: MIMAT0000824
• Previous IDs: rno-miR-103
• Sequence: 52 - agcagcauuguacagggcuauga - 74
• Deep sequencing: 4059051 reads, 509 experiments
• Evidence: experimental; cloned [1-4], Northern [1,3], SOLiD [5]
• Predicted targets:
  • TargetScanVert:rno-miR-103-3p
  • miRDB:rno-miR-103-3p
  • microrna.org:rno-miR-103-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).