![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-27b |
||||||||||
Accession | MI0000859 (change log) | |||||||||
Description | Rattus norvegicus miR-27b stem-loop | |||||||||
Gene family | MIPF0000036; mir-27 | |||||||||
Literature search |
![]()
38 open access papers mention rno-mir-27b | |||||||||
Stem-loop |
- - aaca auug ugau 5' accu cucu aggugcagagcuuagcug gugaacag uggu |||| |||| |||||||||||||||||| |||||||| ||| u 3' ugga gaga uccacgucuugaaucggu cacuuguu gccu g a --ag --ga --uc |
|||||||||
Deep sequencing |
| |||||||||
Confidence |
Annotation confidence: high
| |||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
Mature sequence rno-miR-27b-5p |
|
Accession | MIMAT0017101 |
Previous IDs | rno-miR-27b* |
Sequence |
19 - agagcuuagcugauuggugaacag - 42 |
Deep sequencing | 24803 reads, 487 experiments |
Evidence | experimental; SOLiD [4] |
Predicted targets |
|
Mature sequence rno-miR-27b-3p |
|
Accession | MIMAT0000798 |
Previous IDs | rno-miR-27b |
Sequence |
61 - uucacaguggcuaaguucugc - 81 |
Deep sequencing | 22095870 reads, 508 experiments |
Evidence | experimental; cloned [1-3], SOLiD [4] |
Predicted targets |
|
References |
|
1 | |
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:17805466
"Cloning and identification of novel microRNAs from rat hippocampus"
Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
|
4 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|