Stem-loop sequence mmu-mir-365-1

Accession

MI0000768 (change log)

Symbol

MGI:Mir365-1

Description

Mus musculus miR-365-1 stem-loop

Gene family

MIPF0000061; mir-365

Literature search

25 open access papers mention mmu-mir-365-1
(93 sentences)

Stem-loop

   acc      aa        ac           ga    uuucca 
5'    gcaggg  aaugaggg  uuuugggggca  ugug      u
      ||||||  ||||||||  |||||||||||  ||||      u
3'    cguucu  uuauuccu  aaaauccccgu  auac      c
   --a      cg        -a           -a    uaucgc 

Deep sequencing

28235 reads, 223 reads per million, 105 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR245. The sequence is unrelated to C. elegans mir-245 (MI0000321).

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr16: 13453840-13453926 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from mmu-mir-365-1

• mmu-mir-193b: chr16: 13449523-13449601 [+]
• mmu-mir-365-1: chr16: 13453840-13453926 [+]

Database links

• EntrezGene:Mirn365-1
• MGI:Mir365-1
• RNAcentral:URS000075E14A_10090
• miRBase Tracker:MI0000768

Mature sequence mmu-miR-365-1-5p

• Accession: MIMAT0017077
• Previous IDs: mmu-miR-365-1*
• Sequence: 16 - agggacuuuugggggcagaugug - 38
• Deep sequencing: 1102 reads, 59 experiments
• Evidence: experimental; Illumina [4]
• Database links:
  • RNAcentral:URS000031B6ED_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-365-1-5p
  • miRDB:mmu-miR-365-1-5p

Mature sequence mmu-miR-365-3p

• Accession: MIMAT0000711
• Previous IDs: mmu-miR-365
• Sequence: 56 - uaaugccccuaaaaauccuuau - 77
• Deep sequencing: 54125 reads, 105 experiments
• Evidence: experimental; cloned [2], Illumina [3-4]
• Database links:
  • RNAcentral:URS00003E7283_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-365-3p
  • miRDB:mmu-miR-365-3p
  • microrna.org:mmu-miR-365-3p

References

1. PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).