Stem-loop sequence mmu-mir-128-2

Accession

MI0000726 (change log)

Previous IDs

mmu-mir-128b

Symbol

MGI:Mir128-2

Description

Mus musculus miR-128-2 stem-loop

Gene family

MIPF0000048; mir-128

Literature search

76 open access papers mention mmu-mir-128-2
(638 sentences)

Stem-loop

          a          aug      aa    g gag 
5' caguggg aggggggccg   cacugu  gaga u   u
   ||||||| ||||||||||   ||||||  |||| |    
3' gucaucc uuucucuggc   gugaca  cucu g   a
          c          caa      --    g acg 

Deep sequencing

738934 reads, 1.46e+03 reads per million, 106 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The most commonly cloned mature sequences derived from the previously annotated mir-128a and mir-128b were shown by Landgraf et al to be identical [3]. The sequences are therefore renamed mir-128-1 and mir-128-2.

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr9: 112118636-112118711 [-]
• Overlapping transcripts:

  sense

  OTTMUST00000088278 ; Arpp21-007; intron 14

  OTTMUST00000088286 ; Arpp21-015; intron 15

  OTTMUST00000088284 ; Arpp21-013; intron 15

  OTTMUST00000088285 ; Arpp21-014; intron 16

  OTTMUST00000088274 ; Arpp21-003; intron 16

  OTTMUST00000088276 ; Arpp21-005; intron 17

  OTTMUST00000088272 ; Arpp21-001; intron 19

  ENSMUST00000083507 ; Mir128-2-201; exon 1

  ENSMUST00000159451 ; Arpp21-007; intron 14

  ENSMUST00000160240 ; Arpp21-015; intron 15

  ENSMUST00000159246 ; Arpp21-013; intron 15

  ENSMUST00000162065 ; Arpp21-014; intron 16

  ENSMUST00000159432 ; Arpp21-003; intron 16

  ENSMUST00000035085 ; Arpp21-005; intron 17

  ENSMUST00000111872 ; Arpp21-202; intron 17

  ENSMUST00000164754 ; Arpp21-203; intron 17

  ENSMUST00000070218 ; Arpp21-201; intron 17

  ENSMUST00000162097 ; Arpp21-001; intron 19

Database links

• EntrezGene:Mir128-2
• MGI:Mir128-2
• RNAcentral:URS000075C214_10090
• miRBase Tracker:MI0000726

Mature sequence mmu-miR-128-2-5p

• Accession: MIMAT0017069
• Previous IDs: mmu-miR-128-2*
• Sequence: 11 - gggggccgaugcacuguaagaga - 33
• Deep sequencing: 13591 reads, 28 experiments
• Evidence: experimental; Illumina [5]
• Database links:
  • RNAcentral:URS00005CB6C2_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-128-2-5p
  • miRDB:mmu-miR-128-2-5p

Mature sequence mmu-miR-128-3p

• Accession: MIMAT0000140
• Previous IDs: mmu-miR-128a;mmu-miR-128
• Sequence: 48 - ucacagugaaccggucucuuu - 68
• Deep sequencing: 1452493 reads, 106 experiments
• Evidence: experimental; cloned [3], Illumina [4-5]
• Database links:
  • RNAcentral:URS000024A59E_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-128-3p
  • miRDB:mmu-miR-128-3p
  • microrna.org:mmu-miR-128-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).