![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-221 |
||||||
Accession | MI0000709 (change log) | |||||
Symbol | MGI:Mir221 | |||||
Description | Mus musculus miR-221 stem-loop | |||||
Gene family | MIPF0000051; mir-221 | |||||
Literature search |
![]()
197 open access papers mention mmu-mir-221 | |||||
Stem-loop |
a cugg a - ug u auuu - u 5' uccaggu ggc ugaa cc gca acaauguag cugu guu g ||||||| ||| |||| || ||| ||||||||| |||| ||| u 3' aggucca ucg acuu gg cgu uguuacauc gaca cgg u a ---- g u gu c ---- a a |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
Mouse mir-221 is predicted [2] based on homology to a reported miR from human (MI0000298) [1]. Its expression was later verified by cloning [3]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-221-5p |
|
Accession | MIMAT0017060 |
Previous IDs | mmu-miR-221* |
Sequence |
20 - accuggcauacaauguagauuucugu - 45 |
Deep sequencing | 33185 reads, 101 experiments |
Evidence | experimental; 454 [5], Illumina [6] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-221-3p |
|
Accession | MIMAT0000669 |
Previous IDs | mmu-miR-221 |
Sequence |
60 - agcuacauugucugcuggguuuc - 82 |
Deep sequencing | 1166826 reads, 107 experiments |
Evidence | experimental; cloned [3], Illumina [4,6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12624257
"Vertebrate microRNA genes"
Science. 299:1540(2003).
|
2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|